Skip to content

Protocol

Introduction

Insight into the clonal composition of a population of cells during key events such as development, infection, tumor progression, or treatment response, is critical to understanding the nature of the interaction between cells and the selective forces shaping them. While advances in genomics and transcriptomics and the advent of single-cell RNA sequencing (scRNA-seq) have vastly increased the resolution at which we can understand cellular processes, they lack the ability to directly assign clonal relationships. To meet this need, lineage tracing technologies, such as DNA barcoding, have been developed to label and track individual cells and their progeny 56,57. In DNA barcoding, each individual cell in a population is labeled with a unique random string of nucleotides that is integrated into the genome and heritable by its daughter cells. The ensemble of all DNA barcodes in the cell population can be quantified by next-generation sequencing (NGS) to determine how clonal abundance changes over time.

While highly informative, DNA barcoding and other lineage tracing techniques are still limited in that interesting lineages/clones of cells cannot be easily isolated from the bulk population for clonally pure analysis. Here, we describe a detailed protocol for ClonMapper, a workflow that enables precise identification and isolation of populations of interest from heterogeneous mammalian cells 58. ClonMapper is a functionalized variant of DNA barcoding in which the DNA barcode is a CRISPR-Cas9 compatible single-guide RNA (sgRNA). The sgRNA-barcode has multiple functionalities: (1) It is an integrated DNA barcode, (2) It is transcribed and captured in scRNA-seq workflows, and (3) It can be used to actuate lineage-specific genes of interest using an activator variant of Cas9 59. This protocol describes the use of ClonMapper for lineage-specific activation of Green Fluorescent Protein, enabling isolation of clonal cells from a heterogeneous population.

The sgRNA barcode is engineered using the CROPseq method 60 such that the sgRNA barcode is transcribed by both RNA polymerase III and RNA polymerase II, creating a functional sgRNA barcode transcript and a polyadenylated transcript containing the barcode, respectively.

Cells are first transduced with lentivirus containing a ClonMapper sgRNA barcode vector at a low multiplicity of infection (MOI) to minimize the integration of multiple barcodes per cell. The sgRNA barcode is co-expressed with blue fluorescent protein (BFP) for easy identification and collection of barcoded cells via flow cytometry and fluorescence-activated cell sorting (FACS). Once established, the barcoded cell population is available for experimental manipulation. Clonal dynamics may be measured by NGS analysis and gene expression signatures of clonal populations may be resolved by scRNA-seq. Once a barcode of interest is identified from NGS or scRNA-seq, the barcode identifier can be exploited for isolation of the clone. This is achieved by transfecting the cell population with a plasmid containing an activator variant of Cas9, dCas9-VPR, and a second plasmid containing the Cas9-homing PAM sites adjacent to the identified barcode upstream of a super-folding green fluorescent protein (sfGFP) reporter. Expression of sfGFP will occur only in cells that are producing the matching sgRNA barcode, allowing precise identification and FACS isolation of cells from lineages of interest.

This protocol was originally developed by Aziz Al'Khafaji in the Brock Lab at the University of Texas at Austin. It was written and published in Methods in Molecular Biology by Andrea Gardner and Daylin Morgan. This version has been updated with the Brock Lab's current best practices.

Materials

Equipment

  1. Electroporator
  2. Mammalian cell incubator
  3. Bacterial cell incubator with shaking
  4. Thermocycler
  5. Gel electrophoresis box
  6. Bioanalyzer
  7. Illumina sequencer
  8. Flow cytometer with filters for BFP (Ex: 380/20, Em: 460/40)

Disposables

  1. Sterile filtered pipette tips
  2. 1.5 mL microcentrifuge tubes (sterile)
  3. 1.8 mL Screw top cryovials (sterile)
  4. 20 mL Luer-tapered syringe (sterile)
  5. 0.45 µm polyethersulfone (PES) syringe filter
  6. 30,000 molecular weight cutoff (MWCO) PES concentrator capable of processing 20 mL

Biologics

  1. Electrocompetent E. coli suitable for unstable DNA (restriction minus, endonuclease deficient, and recombination deficient)
  2. Cells of interest 1

Plasmids

  1. CROPseq gRNA expression transfer vector, Cropseq-BFP-WPRE-TS-hU6-BsmbI (Addgene #137993;Brock Lab AA112)
  2. Lentiviral packaging plasmid, VSV-G (Addgene #14888)
  3. Lentiviral packaging plasmid, psPAX2 (Addgene #12260)
  4. dCas9-VPR (Addgene #63798)
  5. Recall-miniCMV-sfGFP (Addgene #137995;Brock Lab AA158)

Primers

see Oligonucleotides

Buffers

  1. Buffer 3.1: 100 mM NaCl, 50 mM Tris-HCl, 10 mM MgCl2, 100 µg/mL BSA, pH 7.9 at 25°C
  2. NEB 5X Q5 Reaction Buffer
  3. 10X T4 PNK Buffer
  4. 10 mM dNTPs
  5. 1X Tris-acetate-EDTA (TAE)
  6. FACS Buffer: 5% FBS, 1-5 mM EDTA, 95% Phosphate-Buffered Saline

Enzymes

  1. BsmBI (10,000 TU/mL)
  2. BbsI (10,000 TU/mL)
  3. NEB Q5 polymerase
  4. T4 ligase (400,000 TU/mL)
  5. T7 ligase (3,000,000 TU/mL)
  6. PNK (10,000 TU/mL)

Other Reagents

  1. LipofectamineTM 3000
  2. Nuclease-free water
  3. Agarose
  4. DNA Clean and Concentrator kit
  5. 2xYT microbial growth medium
  6. Dulbecco's Modified Eagle Medium (DMEM)
  7. OptiMEMTM reduced serum medium
  8. Fetal Bovine Serum (FBS)
  9. Carbenicillin
  10. AmpureXP beads for PCR cleanup
  11. 70% molecular biology grade ethanol in nuclease-free water
  12. 10 mg/mL hexadimethrine bromide
  13. 0.05% Trypan blue
  14. Plasmid Midi-Prep Kit
  15. DNA gel purification kit

Computational

  1. Linux Computing Environment (Such as University HPC)
  2. Python >=3.8
  3. Cell Ranger (for 10X analysis)
  4. Pycashier

see also Recommended Reagents

Methods

ClonMapper Barcode Plasmid Library Assembly

In this step we will generate a high-diversity barcode plasmid library. At this stage there is an opportunity to customize the gRNA design. To maximize diversity you should order a forward oligonucleotide containing an N20 sequence. However, it's also possible to insert known sequences at either the 5'/3' end or to require alternating strong weak bases. This protocol as written should produce approximately 20 (50 mL) bacteria cell pellets.

  1. Perform a 4X extension reaction to generate the double-stranded gRNA insert. Mix the below reagents to create a 50 µL reaction.2

    Reagent volume (µL)
    5X Q5 Reaction Buffer 10
    10 mM dNTPs 1
    100 µM CROPseq-PrimeF-BgL-BsmBI 2
    100 µM CROPseq-RevExt-BgL-BsmBI 1
    Q5 Polymerase 0.5
    nuclease-free water to 50
  2. Run the extension reaction on a thermocycler using the following settings, repeating steps 2-3 for 10 cycles:

    Step Temp (°C) Time
    1 98 2 min
    2 65 30 sec
    3 72 10 sec
    4 72 2 min
    5 4 hold
  3. Clean and concentrate double-stranded gRNA insert PCR product and elute in 30 µL nuclease-free water. Confirm dsDNA assembly on 2% agarose gel by running single stranded DNA against PCR product.

  4. Digest 5-10 µg of CROPseq vector backbone in a reaction containing 20 µL Digestion Buffer 3.1, 8 µL BsmBI, and nuclease-free water to 200 µL for 4 hours at 55°C
  5. Run the digested backbone on a 1-1.5% low melting point agarose gel, then follow the instructions on a DNA gel purification kit to extract and purify the linearized plasmid band.
  6. Ligate double stranded gRNA insert into linearized transfer vector backbone at a molar ratio of 10:1 in a 50X Golden Gate assembly reaction by mixing the below reagents3:

    Reagent volume (µL)
    1.25 pmol linearized backbone variable
    12.5 pmol gRNA insert variable
    T4 Ligase Buffer 50
    T7 Ligase 25
    BsmBI 25
    nuclease-free water to 500
  7. Run the Golden Gate assembly reaction on a thermocycler overnight using the following settings, repeating steps 1-2 for 99 cycles:

    Step Temp (°C) Time
    1 42 2 min
    2 16 5 min
    4 55 30 min
    5 4 hold
  8. Clean barcoding library plasmid pool using a DNA clean and concentrator kit and elute in 22 µL warm, nuclease-free water.4

  9. Prepare for E. coli electroporation by pre-warming recovery media to room temperature, thawing electrocompetent E. coli on ice, and pre-chilling 2 mm electroporation cuvettes on ice.5
  10. Aliquot 100 µL of E.coli into the chilled 0.2 cm electroporation cuvette, add 5 µL of purified assembled plasmid, and stir with pipet tip.6
  11. Transform E. coli by electroporating with 1 pulse at 2.5 kV.7
  12. Add 2 mL Recovery Media and gently pipet up and down immediately after electroporation, and transfer to a sterile 50 mL conical tube.
  13. Repeat steps 10-12 three times
  14. Allow cells to recover for 30 min at 37 °C with shaking at 250 rpm.
  15. Pre-warm 2xYT agar plates with 100 µg/mL carbenicillin.
  16. After recovery, perform dilution plating 1:104, 1:105, 1:106 on carbenicillin agar plates.
  17. Incubate plates overnight at 37 °C.
  18. Put the remaining transformant mixture into 500 mL 2xYT with 100 µg/mL carbenicillin in a 2 L flasks.
  19. Incubate flasks at 30 °C overnight with shaking at 250 rpm.
  20. The culture can be pelleted or midi/maxi prepped for usage.
  21. Calculate transformation efficiency from dilution plating.8

ClonMapper Barcode Sampling

The diversity of the initial plasmid pool should be assessed to ensure a sufficiently high diversity. To do this, a two-stage PCR is performed first with primers flanking the gRNA, followed by a second reaction with primers containing Illumina indices/adapters.

For primer sequences see Oligonucleotides. For pre-generated stage 2 sequences containing i5/i7 adapters see docs.brocklab.com/clonmapper/sequences.

  1. Midi-prep one tube of transformed E. coli from step ClonMapper Barcode Plasmid Library Assembly according to manufacturer's instructions.

  2. Generate the phasing primer mixture 'CM-FWD-S1-PAS' by mixing equimolar amounts of CM-FWD-S1-PASx0, CM-FWD-S1-PASx4, CM-FWD-S1-PASx7, and CM-FWD-S1-PASx8.9

  3. Prepare stage 1 PCR reaction to amplify barcodes by mixing the following reagents:

    Reagent volume (µL)
    5X Q5 Reaction Buffer 10
    10 mM dNTPs 1
    10 µM CM-FWD-S1-PAS 2.5
    10 µM CM-REV-S1 2.5
    Q5 Polymerase 0.5
    100 ng DNA variable
    nuclease-free water to 50
  4. Amplify barcodes by running 50 µL reaction on a thermocycler using the following settings10, repeating steps 2-4 for 10 cycles11:

    Step Temp (°C) Time
    1 95 5 min
    2 98 10 sec
    3 63 30 sec
    4 72 15 sec
    5 72 2 min
    6 15 hold
  5. Clean stage 1 reaction as described in Appendix: AmpureXP Bead PCR Cleanup.

  6. Prepare stage 2 PCR reaction to attach index sequences and Illumina adapters by mixing the following reagents:

    Reagent volume (µL)
    5X Q5 Reaction Buffer 10
    10 mM dNTPs 1
    10 µM CM-FWD-S2-i5 2.5
    10 µM CM-REV-S2-i7 2.5
    Q5 Polymerase 0.5
    4 ng stage 1 amplicon variable
    nuclease-free water to 50
  7. Amplify the barcodes by running the 50 µL reaction on a thermocycler using the above cycling parameters from stage 1, repeating steps 2-4 for 8 cycles 11.

  8. Clean stage 2 reaction as described in Appendix: AmpureXP Bead PCR Cleanup.

ClonMapper Lentivirus Production

In this step, we will generate the lentivirus used to integrate barcode gRNA sequences into our cells of interest. It's important that the necessary precautions are taken when handling live lentivirus. You should consult your local intuitions instructions and viral-handling protocols. Given batch to batch variation, and the need to control viral titer for individual cell lines, it is helpful to make large concentrated batches of virus to give you sufficient material to establish barcoded cell lines.

  1. 48 hours before transfection, plate 0.22-0.25 x 106 low-passage HEK-293T cells in DMEM supplemented with 10% FBS without antibiotics in each well of a sterile 6-well tissue culture treated plate such that cells will be 70-80% confluent at the time of transfection.
  2. On the morning of transfection, replace media on HEK-293T cells with 2 mL of fresh Opti-MEMTM (or your cells growth medium) supplemented with 10% FBS without antibiotics.
  3. In the afternoon, warm Opti-MEMTM, LipofectamineTM 3000, p3000TM, VSV-G, psPAX, and ClonMapper barcode library plasmid to room temperature.12,13
  4. Per well of a 6 well plate, prepare "Tube A" containing 125 µL Opti-MEMTM and 7 µL LipofectamineTM 3000.14
  5. Incubate "Tube A" at room temperature for 5 minutes.
  6. Per well of a 6 well plate, prepare "Tube B" containing 125 µL Opti-MEMTM, 1.5 µg psPax, 0.4 µg VSV-G, 3-5 µg ClonMapper barcode library plasmid and p3000TM (µL/µg DNA).
  7. Slowly add "Tube B" dropwise to "Tube A" and carefully mix by gently inverting 10 times
  8. Incubate at room temperature for 20 minutes.
  9. Add 250 µL of the transfection mix slowly and dropwise to each well of HEK-293T cells.
  10. 16-18 hours post-transfection, carefully remove and dispose of media containing LipofectamineTM 3000 complexes and slowly replenish with DMEM supplemented with 20% FBS without antibiotics.15,16
  11. 48 hours post-transfection, harvest viral containing supernatant and store in a 50 mL conical tube at 4 °C.17,18,19
  12. Spin down collected viral containing supernatant at 500 x g for 10 min at 4 °C to remove residual HEK-293T cells.
  13. Remove plunger from 20 mL syringe and attach to a 0.45 µm PES syringe filter.
  14. Transfer viral supernatant to the 20 mL syringe.
  15. Filter viral supernatant through 0.45 µm PES syringe filter into a fresh 50 mL conical tube to remove any remaining cell debris.
  16. Concentrate virus ~20X in 30,000 MWCO PES ultrafiltration centrifugal concentrator by loading 20 mL of filtered viral supernatant into concentrator chamber and spinning at 4000 x g for 60-75 minutes at 4 °C until ~1 mL of media remains in filter.20
  17. Aliquot 25-50 µL of concentrated virus in threaded cryovials and store at -80 °C.21,22
  18. After freezing use a small amount of virus to determine viral titer on your cell line of interest (see Appendix: Determine Viral Titer).

Integrating ClonMapper Barcodes in Cells

Using the concentrated lentivirus generated in the previous section you should transduce your cells of interest. See Appendix: Determine Viral Titer for typical forward and reverse transduction/viral titer procedures.

It is critical that you infect your cells with a low (~0.1) multiplicity of infection (MOI), in order to limit the chances of a multiple integration event. To control the MOI you should titer every batch of concentrated virus on your specific cell line of interest.

Once you have ascertained the viral titer, you should transduce your cells and separate blue fluorescent protein (BFP) positive cells using FACS. When sorting live cells you should take all necessary efforts to maximize cell viability for your cell line of interest. So long as you have a low MOI you can control the starting diversity of your barcoded cell library using the total number of sorted cells as a proxy. Note that you are likely to recover fewer barcodes than cells you sort due to stochastic outgrowth and death following sort. The total number of barcodes recovered is typically half of the initial number of cells sorted.

The actual number of barcodes should be confirmed as soon as the population has sufficiently outgrown and archives have been prepared. Cell libraries should also be frequently sampled prior to and following any experiments to monitor changes in barcode diversity through the course of routine cell culture maintenance.

ClonMapper Barcode Sampling of Cells

Barcodes are amplified from cellular genomes similar to the plasmid library as described above. Barcoded cell libraries should be assessed to ensure a sufficiently high diversity at time of initial archival. Crucially, any experiments involving barcoded cells should be carried out diligently to prevent population skewing over time. The below protocol assumes a high amount of starting material (2 µg) in order to sample ~300,000 cells. However, it's possible to amplify from a smaller starting amount of gDNA by increasing the total number of cycles from 20.

For primer sequences see Oligonucleotides. For pre-generated stage 2 sequences containing i5/i7 adapters see docs.brocklab.com/clonmapper/sequences.

Preparing Samples for Sequencing

  1. To assess cell barcode diversity harvest cells from culture and collect into cell pellet.23
  2. Isolate genomic DNA from cell pellet using kit or standard protocol and proceed to PCR amplification.
  3. Generate the phasing primer mixture 'CM-FWD-S1-PAS' by mixing equimolar amounts of CM-FWD-S1-PASx0, CM-FWD-S1-PASx4, CM-FWD-S1-PASx7, and CM-FWD-S1-PASx8.9
  4. Prepare stage 1 PCR reaction to amplify barcodes by mixing the following reagents24:

    Reagent volume (µL)
    5X Q5 Reaction Buffer 10
    10 mM dNTPs 1
    10 µM CM-FWD-S1-PAS 2.5
    10 µM CM-REV-S1 2.5
    Q5 Polymerase 0.5
    2 µg DNA variable
    nuclease-free water to 50
  5. Amplify barcodes by running 50 µL reaction on a thermocycler using the following settings10, repeating steps 2-4 for 20 cycles11:

    Step Temp (°C) Time
    1 95 5 min
    2 98 10 sec
    3 63 30 sec
    4 72 15 sec
    5 72 2 min
    6 15 hold
  6. Clean stage 1 reaction as described in Appendix: AmpureXP Bead PCR Cleanup.

  7. Prepare stage 2 PCR reaction to attach index sequences and Illumina adapters by mixing the following reagents:

    Reagent volume (µL)
    5X Q5 Reaction Buffer 10
    10 mM dNTPs 1
    10 µM CM-FWD-S2-i5 2.5
    10 µM CM-REV-S2-i7 2.5
    Q5 Polymerase 0.5
    4 ng stage 1 amplicon variable
    nuclease-free water to 50
  8. Amplify the barcodes by running the 50 µL reaction on a thermocycler using the above cycling parameters from stage 1, repeating steps 2-4 for 8 cycles. 11

  9. Clean stage 2 reaction as described in Appendix: AmpureXP Bead PCR Cleanup.

Processing Barcode Sequencing Data

See pycashier for more info about how to get started processing fastq data to extract barcode information.

Recall Plasmid Assembly

Once you have identified a barcode of interest within your cell library, you can generate a "Recall" plasmid to drive expression of green fluorescent protein (GFP) to isolate or track your clone of interest.

  1. 3 pairs of overlapping oligos containing the barcode sequence of interest flanked by overlapping sequences should be ordered according to Table 1.25
  2. In separate tubes, mix each of the 100 µM oligo pairs together:

  3. Tube AB: 10 µL Bg-AB-fwd + 10 µL Bg-AB-rev

  4. Tube BC: 10 µL Bg-BC-fwd + 10 µL Bg-BC-rev
  5. Tube CD: 10 µL Bg-CD-fwd + 10 µL Bg-CD-rev

  6. Heat each to 80 °C and let cool to create DNA blocks containing a barcode, a PAM site, and overhang sequences.26

  7. Ligate DNA blocks together creating the 3X-barcode array by mixing the following reagents:

    Reagent volume (µL)
    Tube "AB" 10
    Tube "BC" 10
    Tube "CD" 10
    10 mM dNTPs 5
    10x T4 PNK Buffer 5
    T4 PNK 1
    nuclease-free water 9
  8. Incubate at 37 °C for 45 minutes.

  9. Add 2 µL T7 DNA ligase to the 50 µL mixture and incubate at room temperature overnight.
  10. Run ligation product in a 2% agarose gel and gel purify band from approximately 170 bp.
  11. Ligate the 3X-barcode-array into the recall plasmid backbone at a molar ratio of 10:1 in a Golden Gate assembly reaction by mixing the following reagents:

    Reagent volume (µL)
    Recall-miniCMV-sfGFP 25 fmol
    3X-barcode-array 250 fmol
    T4 ligase buffer 1 µL
    T7 ligase 0.5 µL
    BbsI 0.5 µL
    nuclease-free water to 10 µL
  12. Run the Golden Gate assembly reaction on a thermocycler using the following settings, repeating steps 1-2 for 35 cycles:

    Step Temp (°C) Time
    1 42 2 min
    2 16 5 min
    3 55 30 min
    4 4 hold
  13. Transform bacteria with golden gate product. See Addgene for standard protocol.

  14. Verify insertion of barcode array into Recall-miniCMV-sfGFP backbone via Sanger sequencing.

Recall and Isolation of Barcoded Cells

With a barcode-specific recall vector you can isolate a clonal sub-population from your barcoded cell library. See below for the general procedure, but note that it may be necessary to optimize transfection and live-cell sorting for your specific cells of interest.

See notes 27,28

  1. 24-48 hours before performing recall transfection, seed your cell line of interest in growth medium in a 6-well plate such that it is near 60-80% confluent at time of transfection.
  2. Per well of a 6 well plate, prepare "Tube A" containing 100 µL Opti-MEMTM and 9 µL LipofectamineTM 3000.14
  3. Incubate "Tube A" at room temperature for 5 minutes.
  4. Per well of a 6 well plate, prepare "Tube B" containing 125 µL Opti-MEMTM, 225 ng Recall plasmid, 275 ng dCas9-VPR plasmid and 2 µL/µg DNA of p3000.
  5. Slowly add "Tube B" dropwise to "Tube A" and carefully mix by gently inverting 10 times.
  6. Incubate at room temperature for 20 minutes.
  7. Add 225 µL of the transfection mix slowly and dropwise to each well of adherent cells.
  8. 16-18 hours post-transfection, carefully remove media containing LipofectamineTM 3000/DNA complexes and slowly replenish with growth medium supplemented with 20% FBS without antibiotics.
  9. 48-72 hours post-transfection, dissociate cells from the plate and wash cells with PBS twice at 300 x g for 5 minutes at 4 °C before resuspending in chilled FACS buffer.45
  10. Pass cells resuspended in FACS buffer through a 35 µm nylon mesh strainer into a 5 mL flow cytometry test tube and keep on ice.
  11. Use control samples to set laser voltages on FSC-A, SSC-A, BFP, and GFP on FACS sorter such that nearly all cells are seen within FSC-A vs. SSC-A plot and both negative and positive populations can be seen and distinguished on the BFP and the GFP channel. Set compensations based on single positive populations.29
  12. Set sort gate on GFP and BFP double positive gate indicative of a recalled cell.30
  13. Sort cells in GFP and BFP double positive gate.31
  14. Maintain sorted cells in culture with complete growth medium.

Appendix

See below for general purpose procedures related to ClonMapper.

AmpureXP Bead PCR Cleanup

  1. Transfer 50 µL PCR amplification product to a nuclease-free microcentrifuge tube
  2. Allow AmpureXP beads to come to room temperature.
  3. Add 35 µL (0.7X) AmpureXP beads and mix well with vortexing or pipetting up and down 10 times.
  4. Incubate at room temperature for 5 minutes.
  5. Place the tube on a magnetic rack and allow solution to clear (5-10 minutes).
  6. While the tube is on the rack transfer the clear supernatant to a new tube without disturbing the bead pellet.
  7. Add 45 µL (1.6-0.7x) AmpureXP beads to the supernatant from step 10 and mix well with vortexing or pipetting up and down 10 times.
  8. Incubate at room temperature for 5 minutes.
  9. Place the tube on a magnetic rack and allow solution to clear (5-10 minutes).
  10. With the tube still in the rack, aspirate the clear supernatant.
  11. With the tube still in the rack, add 180 µL of 80% ethanol and allow it to sit for 30 seconds.32
  12. With the tube still in the rack, aspirate the ethanol and repeat step 11.
  13. Remove supernatant and allow bead to dry for no more than 5 minutes.33
  14. Remove tube from the magnetic rack and elute DNA by adding 42 µL of nuclease-free water.
  15. Incubate at room temperature for 10 minutes.
  16. Transfer tube to magnetic rack and collect 40 µL of purified PCR product after solution has cleared (5-10 minutes).34
  17. Quantify DNA yield with a high sensitivity fluorometry kit ensuring yield between 0.5-10 ng/µL.

Determine Viral Titer

See 35,36

Titering on Adherent Cells (Forward Procedure)

37

  1. 24-48 hours before performing viral transduction seed your cell line of interest in a 12-well plate such that it is near 60-70% confluent at time of transduction.
  2. Prior to transduction, one well of the replicate 12 wells should be dissociated and counted using trypan blue exclusion on a hemocytometer to know approximate number of live cells at time of transduction.38,39
  3. Create stock of media containing your cells' standard growth medium supplemented with 20% FBS containing 0-10 µg/mL hexadimethrine bromide (1:1000 dilution from hexadimethrine bromide stock to get 10 µg/mL).40
  4. Place 600 µL of hexadimethrine bromide containing medium into separate microcentrifuge tubes.
  5. Add virus in increasing amounts to each tube.
  6. Replace media on cells of interest with virus and hexadimethrine bromide containing dilutions.
  7. Incubate for 16 hrs at 37 °C, then carefully remove viral containing supernatant and replace with complete growth medium.42,43
  8. Incubate for an additional 32 hrs at 37 °C, then remove medium and wash each well gently with PBS.44
  9. Dissociate the cells from the plate and centrifuge at 300 x g for 5 minutes at 4 °C.
  10. Wash cell pellets with PBS and repeat spin. Perform this step three times to ensure removal of trace virus before flow cytometry.
  11. Resuspend cells in chilled FACS Buffer.45
  12. Keep cells on ice and continue to step Flow Cytometry to Determine Viral Titer

Titering on Suspension Cells

  1. Count your cells of interest using a hemocytometer.
  2. Create stock of media containing your cells' standard growth medium supplemented with 20% FBS containing 0-10 µg/mL hexadimethrine bromide (1:1000 dilution from hexadimethrine bromide stock for 10 µg/mL).40
  3. Resuspend 1.20 x 106 cells in 7.2 mL of containing hexadimethrine bromide media such that the final solution contains 1 x 105 cells in 600 µL.
  4. Plate 600 µL of cell solution in 10 wells of a tissue culture treated 12-well plate
  5. Add virus in increasing amounts to each well and mix well.41
  6. Incubate for 16 hrs at 37 °C.42,43
  7. Transfer cell suspensions to sterile 1.7 mL microcentrifuge tubes and spin down at 500 x g for 5 minutes at 4 °C.46
  8. Resuspend each cell pellet with complete growth medium and transfer to fresh 12-well plate.
  9. Incubate for an additional 32 hrs at 37 °C, then transfer wells to microcentrifuge tubes and spin down at 400 x g for 5 minutes at 4 °C.47
  10. Wash cell pellets with PBS and repeat spin.48
  11. Resuspend cells in chilled FACS Buffer.45
  12. Keep cells on ice and continue to step Flow Cytometry to Determine Viral Titer

Flow Cytometry to Determine Viral Titer

  1. Pass cells resuspended in FACS buffer through a 35 µm nylon mesh strainer into a 5 mL flow cytometry test tube.49
  2. Use control samples to set laser voltages on FSC-A, SSC-A, and BFP such that nearly all cells are seen within FSC-A vs. SSC-A plot and both negative and positive populations can be seen and distinguished on the BFP channel.50
  3. After setting voltages with control samples, run transduced samples from lowest viral to highest. Set the cytometer to record at least 10,000 events for each sample. Record %BFP-positive for each titration.
  4. Create a plot showing volume of virus on the x-axis and %BFP-positive on the y-axis.51
  5. Calculate viral titer in titering units (TU) per mL using Equation 1 using a pair of values within the linear region of the titer curve.52
\[\frac{\text{TU}}{\text{mL}}\text{=}\frac{\left(\text{Number of cells at time of transduction} \right)\text{ × }\left( \text{Fraction of Positive Cells} \right)}{\left( \text{Volume of virus }\left\lbrack \text{mL} \right\rbrack \right)}\]

ClonMapper Viral Transduction

  1. After calculating the viral titer (TU/mL) on your cell line of interest, determine the final number of cells you require for your experiment using and transduce cells at a multiplicity of infection (MOI) of 0.1 (Equation 2) to minimize the occurrence of multiple barcode integrations.53,54
  2. Use control samples to set laser voltages on FSC-A, SSC-A, and BFP such that nearly all cells are seen within FSC-A vs. SSC-A plot and both negative and positive .populations can be seen and distinguished on the BFP channel.49
  3. Set sort gate on BFP-positive cells indicative of a productive sgRNA barcode.55
  4. Sort cells on BFP-positive gate via FACS.
  5. Maintain sorted cells in culture with complete growth medium.
\[\text{MOI [TU/cell] = }\frac{\left( \text{Volume of Virus needed [mL]} \right)\text{ × }\left( \text{Titer of Virus [TU/mL]} \right)}{\left( \text{Number of cells exposed to virus} \right)}\text{ = 0.1}\]

Tables

Oligonucleotides

Name Sequence (5' to 3') Notes
CROPseq-PrimeF-BgL-BsmBI GAGCCTCGTCTCCCACCGNNNNNNNNNNNNNNNNNNNNGTTTTGAGACGCATGCTGCA The N20 sequence is a random string of oligonucleotides
CROPseq-RevExt-BgL-BsmBI TGCAGCATGCGTCTCAAAAC
CM-FWD-S1-PASx0 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCTTGTGGAAAGGACGAAACAC
CM-FWD-S1-PASx4 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGCAACTTGTGGAAAGGACGAAACAC
CM-FWD-S1-PASx7 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGAGCCACCCTTGTGGAAAGGACGAAACAC
CM-FWD-S1-PASx8 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGTAGTGAATCTTGTGGAAAGGACGAAACAC
CM-REV-S1 GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTC
CM-FWD-S2-i5 AATGATACGGCGACCACCGAGATCTACACNNNNNNNNTCGTCGGCAGCGTC The N8 sequence is where the i5 Illumina index should be placed
CM-REV-S2-i7 CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTCTCGTGGGCTCGG The N8 sequence is where the i7 Illumina index should be placed
BgN20-AB-fwd TACTCGACCAAGAACCGCANNNNNNNNNNNNNNNNNNNNAGGTGGATTAGTTCTCT Insert barcode in place of N20
BgN20-AB-rev AAGCAGAGAACTAATCCACCTNNNNNNNNNNNNNNNNNNNNTGCGGTTCTTGGTCG Insert reverse-complement barcode in place of N20
BgN20-BC-fwd GCTTGTCCTGCGGTTACCCNNNNNNNNNNNNNNNNNNNNAGGCTGTAATCCAGCTG Insert barcode in place of N20
BgN20-BC-rev AGCGCAGCTGGATTACAGCCTNNNNNNNNNNNNNNNNNNNNGGGTAACCGCAGGAC Insert reverse-complement barcode in place of N20
BgN20-CD-fwd CGCTGTGGTATCACTCGTCNNNNNNNNNNNNNNNNNNNNAGGCTCAGCTAAGGTGC Insert barcode in place of N20
BgN20-CD-rev CATTGCACCTTAGCTGAGCCTNNNNNNNNNNNNNNNNNNNNGACGAGTGATACCAC Insert reverse-complement barcode in place of N20
Name Vendor Catalog No.
AMPure XP Reagent Beckman Coulter A63880
BbsI-HF NEB R3539S
BsmBI-v2 NEB R0739S
NEBuffer r3.1 NEB B6003S
Q5 Hot Start Polymerase NEB M0493S
T4 Ligase NEB M0202S
T4 PNK NEB M0201S
T7 Ligase NEB M0318S
Genomic DNA Mini Kit ThermoFisher K182001
Lipofectamine 2000 ThermoFisher 11668030
Lipofectamine 3000 ThermoFisher L3000001
OptiMEM ThermoFisher 31985070
Typan Blue Stain ThermoFisher T10282
2xYT medium Millpore Sigma Y2377-250G
Carbenicillin Millpore Sigma C1389-250MG
DMEM Millpore Sigma D5671
Hexadimethrine bromide Millpore Sigma TR-1003-G
Plasmid Plus Kit (Midi) Qiagen 12941
DNA Clean and Concentrator-5 Zymo D4013

Acknowledgements

This work has been supported by funding through the NIH (R21CA212928 to AB).


  1. Make sure cells are transducible with lentivirus. Timing of lentiviral exposure and detectable expression of transgene will vary across cell types. ↩

  2. Always use filtered pipette tips when working with DNA to prevent cross-contamination. ↩

  3. A 1X Golden Gate assembly reaction is setup by mixing 25 fmol digested gRNA transfer vector backbone, 250 fmol double stranded gRNA barcode DNA, 1 µL T4 ligase buffer, 0.5 µL T7 ligase, 0.5 µL BsmBI, and nuclease-free water to 10 µL. ↩

  4. Letting the water sit on the column for 3-5 minutes before elution increases yield. Re-run elution product through column 3 times to maximize yield. ↩

  5. Make sure to use E. coli suitable for use with unstable DNA. ↩

  6. Do not pipet up and down. Ensure bubbles are not added to the mix which can cause electrical arcing and cell death during electroporation. ↩

  7. Optimal time constants should be between 4.2-5.4 ms. This protocol was optimized with the EC2 setting on the Bio-Rad MicroPulserTM Electroporator. ↩

  8. Transformation efficiency (TE) is defined as the number of colonies produced with transformation with 1 µg of plasmid DNA. To calculate TE, count the number of colonies formed on the plate, calculate the amount of DNA used in µg, and determine your dilution factor. With those variable, TE = Colonies/µg/Dilution. ↩

  9. Universal phase amplicon sequencing primers are used to add more diversity to the sequencing reads which helps prevents sequencing errors. ↩↩

  10. Pre-heat thermocycler to 98 °C before adding tubes to heat block. ↩↩

  11. The number of cycles will depend on the starting template amount. ↩↩↩↩

  12. Lentivirus can promiscuously infect cells, including your skin! Use a cuffed-sleeve lab coat and double-glove (one glove under sleeve cuffs, one glove over) at every step involving use of virus. ↩

  13. Ethanol does not kill lentivirus. Always keep a working stock of 100% bleach in the BSL-2 culture hood in which virus is being handled. Soak pipet tips, serological pipets, and other disposables that come in contact with virus in 100% bleach and irradiate with UV for at least 30 minutes before disposal as biohazardous waste. Wipe down virus containing tissue culture plates with disinfecting wipes certified to kill HIV such as CaviCide before removing from culture hood. ↩

  14. Slowly dilute LipofectamineTM complexes dropwise with Opti-MEMTM media with occasional flicking of the tube. ↩↩

  15. You are working with live virus at this stage and beyond. Stringently adhere to all biosafety procedures. Bleach and UV all media and containers exposed to live virus and virus producing reagents. ↩

  16. Cells exposed to lentivirus are fragile and extra care must be taken in removing and adding media. ↩

  17. Virus should be stored in labeled secondary containment. ↩

  18. Virus-producing HEK-293T cells should be bleached and UV irradiated in culture for at least 30 minutes to inactivate remaining virus before disposal. ↩

  19. Never use a vacuum line to disposal of virus waste as this may produce aerosols. ↩

  20. Spin times will vary based on centrifuge angle. Spinning at 4 °C will increase the amount of time it takes for media to pass through filter (We have noted that 22 mL takes about 75 minutes). ↩

  21. Even just a single freeze-thaw cycle can drastically alter viral titer, be sure to minimize freeze-thaw cycles. ↩

  22. Virus should be completed frozen and then thawed before calculating viral titer. ↩

  23. It is important to ensure that you have enough cells to sufficiently sample your population depending upon the initial barcode diversity. ↩

  24. DNA amount used will be dependent on the nature of the cell population and desired sampling depth. To capture rare events, a maximum of 2 µg of DNA per reaction can be used and multiple reactions can be done. Given that a single diploid human genome is estimated at ~6.6 pg, 2 µg of genomic DNA represents that of ~300,000 cells. To capture only highly represented clonal populations, less DNA can be used. ↩

  25. The barcode sequence should be ordered to match the extracted barcode for the fragments labeled as 'extraction' and in reverse-complement for oligos labeled as 'reversed'. ↩

  26. This process anneals the single stranded DNA oligos together, creating short double stranded DNA blocks that will be ligated together in the next step. ↩

  27. Lipofectamine effiency can vary significantly between cell lines. It's recommended you optimize transfection with a plasmid containing a constitutively promoter. ↩

  28. This protocol is optimized for adherent cell lines. If using suspension lines, electroporation can be done to introduce the plasmids to your cells. Be sure to optimize electroporation parameters on your cells for maximized plasmid expression and minimized cell death before recall electroporation. If electroporating, total plasmid load per cell may vary by cell type. Example: CD8 T cells respond well to 2.5 µg of each plasmid (5 µg total DNA load) per 5 x 105 cells. ↩

  29. Ensure proper controls for flow. Minimally have a positive control singularly positive for BFP, a positive control singularly positive for GFP, and a negative control expressing no fluorescent proteins. ↩

  30. When sorting for recalled cells, use stringent gating. Ensure that 0% of negative control and single positive samples appear in the sorting gate. ↩

  31. Single cell sorting can be performed for isolation and growth of clonal populations. ↩

  32. 80% ethanol should be prepared fresh for each PCR cleanup. ↩

  33. Do not over dry the beads, this can result in a loss of yield and quality. ↩

  34. Beads may become trapped within the meniscus of the water. Pipetting slowly will keep the beads against the wall of the tube and leave them in the remaining 2 µL of water. ↩

  35. Viral titer will vary between cell type and with each new virus preparation. ↩

  36. Lentivirus susceptibility and timing should first be determined on your cells of interest using a control plasmid such as a constitutively active GFP. Some cells will require longer or shorter incubation times with the virus and some cells will take longer to produce the transgenic reporter protein. ↩

  37. To perform reverse titer on adherent cells, follow the steps for titering on suspension cells through step 3.4.2.5, then return to the adherent protocol at step 3.4.1.6. ↩

  38. It is very important to know the number of cells at the time of transduction. This number is used to calculate viral titer. ↩

  39. Trypan blue exclusion is performed by mixing equal parts 0.05% Trypan blue with your cell suspension, usually 10 µL of each, then load 10 µL of the stained suspension into the hemocytometer. ↩

  40. Hexadimethrine bromide is a cationic solution that assists in viral adsorption to cells 61. Hexadimethrine bromide can be toxic to some cells. Hexadimethrine bromide sensitivity should be assessed via serial dilution to determine maximum tolerable hexadimethrine bromide dose before determining viral titer. Most cells respond well to 6-8 µg/mL hexadimethrine bromide. ↩↩

  41. Ensure one well is kept uninfected as a negative control. A range of 0.5-200 µL is usually sufficient to find viral titer, e.g. 0, 0.5, 1, 5, 10, 25, 50, 100, 150, 200 µL. ↩

  42. Lentiviral exposure time will vary across cell type dependent on growth dynamics and properties intrinsic to the cells. Optimize lentiviral exposure time with constitutively active GFP virus before transduction with sgRNA barcoding library virus. ↩↩

  43. Lentiviral exposure times range between 12-48 hours. Lentiviral exposure time should be minimized to reduce the occurrence of multiple viral integrations. ↩↩

  44. Lentivirus transduced cells are very fragile and should be handled with added care. ↩

  45. EDTA and FBS in FACS buffer help to prevent cell clumping. For extra-sticky cells, use 5 mM EDTA in FACS buffer. ↩↩↩

  46. Use a pipette to remove lentivirus containing supernatant and dispose of in bleach. Do not vacuum aspirate, vacuums can cause dangerous viral aerosols. ↩

  47. Lentivirus transduced cells are very fragile and should be handled with added care when pipetting. ↩

  48. Perform this step three times to ensure removal of trace virus before flow cytometry. ↩

  49. Ensure proper controls for flow. Minimally have a positive control expressing BFP and a negative control expressing no fluorescent proteins. ↩↩

  50. BFP populations will be normally distributed. For titer calculations, it is useful to set tight gates such that 99.98% of the negative control cells are captured in the negative gate. ↩

  51. Plot will appear logarithmic. Only values within the linear region of the plot should be used to calculate viral titer (usually between 10-40% BFP-positive). ↩

  52. Example: If 5 µL of virus added to 100,000 cells resulted in 30% BFP-positive cells within the linear region of the titer curve, then the viral titer would be (100,000 x 0.30) / (0.005 mL) = 6.0 x 106 TU/mL ↩

  53. Example: If your viral titer was 6.0 x 106 TU/mL and you wanted to infect 3.0 x 106 cells at an MOI of 0.1, you would need to subject the 3.0 x 106 cells to 50 µL of virus. ↩

  54. A low MOI of 0.1 or below helps prevent occurrence of multiple barcode integrations. In order to uniquely recall cell lineages it is important to maximize the probability that there is one or zero barcodes per cell at the time of transduction. The probability of barcode integration can be modeled as a Poisson distribution 6263. ↩

  55. When sorting for sgRNA barcoded cells, use more stringent gating than used for titer determination. Ensure that 0% of negative control samples appear in the sorting gate. ↩

  56. Jamie R. Blundell and Sasha F. Levy. Beyond genome sequencing: Lineage tracking with barcodes to study the dynamics of evolution, infection, and cancer. Genomics, 104(6):417–430, December 2014. doi:10.1016/j.ygeno.2014.09.005. ↩

  57. Justus M. Kebschull and Anthony M. Zador. Cellular barcoding: lineage tracing, screening and beyond. Nature Methods, 15(11):871–879, November 2018. doi:10.1038/s41592-018-0185-x. ↩

  58. Aziz M. Al'Khafaji, Daniel Deatherage, and Amy Brock. Control of Lineage-Specific Gene Expression by Functionalized gRNA Barcodes. ACS Synthetic Biology, 7(10):2468–2474, October 2018. doi:10.1021/acssynbio.8b00105. ↩

  59. Alejandro Chavez, Jonathan Scheiman, Suhani Vora, Benjamin W Pruitt, Marcelle Tuttle, Eswar P R Iyer, Shuailiang Lin, Samira Kiani, Christopher D Guzman, Daniel J Wiegand, Dmitry Ter-Ovanesyan, Jonathan L Braff, Noah Davidsohn, Benjamin E Housden, Norbert Perrimon, Ron Weiss, John Aach, James J Collins, and George M Church. Highly efficient Cas9-mediated transcriptional programming. Nature Methods, 12(4):326–328, April 2015. doi:10.1038/nmeth.3312. ↩

  60. Paul Datlinger, André F Rendeiro, Christian Schmidl, Thomas Krausgruber, Peter Traxler, Johanna Klughammer, Linda C Schuster, Amelie Kuchler, Donat Alpar, and Christoph Bock. Pooled CRISPR screening with single-cell transcriptome readout. Nature Methods, 14(3):297–301, March 2017. doi:10.1038/nmeth.4177. ↩

  61. Howard E. Davis, Jeffrey R. Morgan, and Martin L. Yarmush. Polybrene increases retrovirus gene transfer efficiency by enhancing receptor-independent virus adsorption on target cell membranes. Biophysical Chemistry, 97(2-3):159–172, June 2002. doi:10.1016/S0301-4622(02)00057-1. ↩

  62. B Fehse, O S Kustikova, M Bubenheim, and C Baum. Pois(s)on – It's a Question of Dose…. Gene Therapy, 11(11):879–881, June 2004. doi:10.1038/sj.gt.3302270. ↩

  63. Olga S. Kustikova, Anke Wahlers, Klaus Kühlcke, Birgit Stähle, Axel R. Zander, Christopher Baum, and Boris Fehse. Dose finding with retroviral vectors: correlation of retroviral vector copy numbers in single cells with gene transfer efficiency in a cell population. Blood, 102(12):3934–3937, December 2003. doi:10.1182/blood-2003-05-1424. ↩